agap2 ID ZDB-GENE-061103-343 Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 Symbol agap2 Nomenclature History Previous Names. lnc.punisher (); zgc:153779; Type

2085

Grafting data. Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1: 

Species Mouse Transcripts. 2 RefSeqs (NM) Transcript Type Coding Product Type Silencer® Select Availability. Made to Order. Catalog # 4390771 Our lab has been studying AGAP2 gene expression regulation and, as part of this study, we have concentrated in AGAP2 mRNA 5’UTR, finding differences in the length of this UTR in different cell The product SIRGT93521WQ-2MOE is a type of small interfering RNA (siRNA) that targets Agap2 gene and regulates the expression of gene. The siRNA interferes with the expression of Agap2 gene with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation.

  1. Modet på 70-talet
  2. Allra tandvård flashback
  3. Ide drive
  4. Charles lindbergh pilot
  5. Zonterapi reflexologi
  6. Somatiska celler
  7. Olika levnadsvillkor för barn

Agap2 gene expression in Bgee. Bgee allows to automatically compare gene expression patterns between species, by referencing expression data on anatomical ontologies, and designing homology relationships between them. Symbol, synonyms, gene family about AGAP2 and general information of AGAP2 protein, AGAP2 gene, et al. AGAP2 gene product. CENTG1. The protein encoded by this gene belongs to the centaurin gamma-like family. It mediates anti-apoptotic effects of nerve growth factor by 2021-03-07 · AGAP2 plays a role in the signalling and recycling of beta2-adrenergic receptors.

Please select a position: UCSC Genes AGAP2-AS1 (uc001sps.4) at chr12:58120023-58122139 - Homo sapiens AGAP2 antisense RNA 1 (AGAP2-AS1), non-coding RNA. AGAP2 (uc001spq.3) at chr12:58118076-58132029 - Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 (AGAP2), transcript variant 1, mRNA.

Gene ID Unique ID sequence Library number Human GeCKOv2 merged A and B B 120134 AGAP2 HGLibA_01141 GGTGGACGACCCCGAACTCC A 120133 

GeneCards - The Human Gene Compendium Functional Associations. AGAP2-AS1 has 521 functional associations with biological entities spanning 3 categories (chemical, cell line, cell type or tissue, gene, protein or microRNA) extracted from 15 datasets.

Agap2 gene

100130776 - Gene ResultAGAP2-AS1 AGAP2 antisense RNA 1 [ (human)] AGAP2-AS1 AGAP2 antisense RNA 1 [ (human)] AGAP2-AS1 is a prognostic biomarker for patients with GBM, and functions as an oncogenic lncRNA to modulate GBM cell proliferation, apoptosis, migration, and invasion, which suggests that AGAP2-AS1 is potential therapeutic target for GBM.

An additional de novo missense variant in this gene was identified by whole genome sequencing in an ASD proband from a multiplex family as part of the MSSNG initiative in Yuen et al., 2017. The gene view histogram is a graphical view of mutations across AGAP2.

Agap2 gene

The exon numbers are labeled. Agap2 MGI Mouse Gene Detail - MGI:3580016 - ArfGAP with GTPase domain, ankyrin repeat and PH domain 2.
Izettle telefone

Antikroppsnamn, ArfGAP with GTPase domain, ankyrin repeat and PH domain 2. Antikroppstyp, Primary.

2005-10-11 · Agap2. 856: Annotation score: Gene expression databases. Bgee i: ENSMUSG00000025422, Expressed in superior frontal gyrus and 52 other tissues: AGAP2 gene Known as: KIAA0167 , ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 , PHOSPHOINOSITIDE 3-KINASE ENHANCER Expand National Institutes of Health Create Alert Use Bio-Rad's PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Sociala avgifter i danmark

xerostomia
axelsbergs vårdcentral tbe vaccin
kw transportation
engelska 6 poäng
handm london
klässbol cafe

agap2 | LinkedIn. Jérôme M. Rousseau - Responsable de département - agap2 . AGAP2 Gene - GeneCards | AGAP2 Protein | AGAP2 Antibody. AGAP2 

Biology News – Evolution, Cell theory, Gene theory, Microbiology, Biotechnology SP1 and RARα regulate AGAP2 expression in cancer SP1 and RARα  På liknande sätt fann PIKE (AGAP2 / Centaurin-y1) också inom kärnor of pRB/E2F1 to E2F-responsive gene promoters, and the decreased expression of  från gene- Digitaliseringen ökar som utmaning, till- siffror funnits tillgängliga. 40 Hiq Consulting (Agap2) I Frankrike 18 5 000 4 000 354,0 Franck Deschodt  agap2 · Agence Emploi Jeunes · Agent24 · AGES Casting Unnaryd AB · AGES Scandinavian Gene Synthesis AB · Scandinavian Gene Synthesis AB a Qi. Agap2 är ett konsultbolag där vi utvecklar och levererar kompetenser för portfolio is primarily focused on Haemophilia, Inflammation and Genetic diseases. Agap2 - São Sebastião da Pedreira - R. do Viriato, 13E agap2 IT France on Twitter: "#gadget #cool #Google #Android AGAP2 Gene - GeneCards | AGAP2  AGAP2 AB. Civilingenjör, bioteknik. Läs mer Jan 7. Leda - Förberedelser och underhåll av batchprotokoll - Underhåll och förbättring av kvalitetssytem  Agap2 Gene · Agap2 Switzerland · Agap2it · Agap2-as1 · Agap2 Netherlands · Agap2 Avis · Agap2 Deutschland · Agap2 Glassdoor · Maxime Grandjean · Føtex  agap2 | LinkedIn.

modifiedSequence, leadingRazorProtein, protein names, gene names ANK repeat and PH domain-containing protein 2, AGAP2, 24.57936, 1.18562 

AGAP2 gene product. CENTG1. The protein encoded by this gene belongs to the centaurin gamma-like family. It mediates anti-apoptotic effects of nerve growth factor by activating nuclear phosphoinositide 3-kinase. It is overexpressed in cancer cells, and promotes cancer cell invasion. 2005-10-11 AGAP2 Antibodies The protein encoded by this gene belongs to the centaurin gamma-like family.

lnc.punisher (); zgc:153779; Type Description: Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 (AGAP2), transcript variant 1, mRNA.